Review



vdac1 3  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Cell Signaling Technology Inc vdac1 3
    Vdac1 3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 495 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vdac1 3/product/Cell Signaling Technology Inc
    Average 97 stars, based on 495 article reviews
    vdac1 3 - by Bioz Stars, 2026-03
    97/100 stars

    Images



    Similar Products

    90
    Microsynth ag vdac1 sirna (5'-3') acacuaggcaccgagauua
    ( A ) Representative time courses of Ψmito before and after 1 μM FCCP treatment in WT (black) and AnxA5-KO (red) HeLa cells stained with TMRM. ( B ) Bar graph shows the relative mitochondrial membrane potential in WT (black) and AnxA5-KO (red) HeLa cells. Data points represent the mean ± SEM (n WT = 87/9; n AnxA5-KO = 106/10). ( C ) Immunoblots show the expression level of AnxA5, <t>VDAC1,</t> MICU1, MICU2, UCP2, MCU, and EMRE in WT and AnxA5-KO HeLa cell lysates. Uncropped blots are provided in the Source data. ( D ) Bar graph shows the expression level analysis of the respective proteins. Data points represent the mean ± SEM (n WT = 3; n AnxA5-KO = 3). ( E ) Representative confocal images of WT and AnxA5-KO HeLa cells were captured, stained with MTR-CMX (magenta), and expressed ERAT4.03 NA (green). Multiplying the fluorescence signals of mitochondria and ER at the pixel level, and subsequently amplifying the resulting signal, led to the visualization of MAM. Images provide an overview of the cells (scale bar = 10 μm), and magnified views of selected regions indicated by dashed squares (scale bar = 1 μm). ( F ) Bar graphs show the ER-mitochondrial co-localization represented by Pearson’s R-value, ( G ) mitochondrial volume, and ( H ) mitochondrial branching (a lower value indicates more branched mitochondria). Data points represent the mean ± SEM (n WT = 91/11; n AnxA5-KO = 88/11). The p -values were calculated using a two-tailed unpaired Student’s t-test for ( F ), p = 0.8780 (ns); for ( G ), p = 0.0092 (** p < 0.01); and for ( H ), p = 0.0036 (** p < 0.01). ( I ) Representative TEM images of mitochondria in WT and AnxA5-KO HeLa cells, where mitochondria are highlighted with magenta (scale bar = 500 nm). ( J ) Bar graphs show the cristae membrane-amount, measured by calculating the perimeter of cristae and normalizing it to the corresponding perimeter of mitochondria, and ( K ) cristae density was calculated by normalizing the perimeter of cristae to the area of mitochondria. Data points represent the mean ± SEM (n WT = 47/2; n AnxA5-KO = 45/2), n represents the number of mitochondria/biological replicates). ( L ) Schematic illustration depicts the spatial cristae membrane density (ρCM) measurement within segmented mitochondria. Iterative measurements of ρCM density were conducted in gradually downsized circular segments. ( M ) shows the spatial ρCM distribution in WT and AnxA5-KO cells by using the methods depicted in ( L ). The x-axis scale ranges from 0 to 100, with 0 indicating the outermost shell of the mitochondrion and 100 representing the mitochondrial center. Data points represent the mean ± SEM (n WT = 44/3; n AnxA5-KO = 47/3). n represents the number of cells/biological replicates (minimum of 3 independent experiments). Significant differences were assessed with the unpaired Student’s t-test or Kolmogorov–Smirnov test (* p < 0.05, ** p < 0.01, and ns: not significant). .
    Vdac1 Sirna (5' 3') Acacuaggcaccgagauua, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vdac1 sirna (5'-3') acacuaggcaccgagauua/product/Microsynth ag
    Average 90 stars, based on 1 article reviews
    vdac1 sirna (5'-3') acacuaggcaccgagauua - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    97
    Cell Signaling Technology Inc vdac1 3
    ( A ) Representative time courses of Ψmito before and after 1 μM FCCP treatment in WT (black) and AnxA5-KO (red) HeLa cells stained with TMRM. ( B ) Bar graph shows the relative mitochondrial membrane potential in WT (black) and AnxA5-KO (red) HeLa cells. Data points represent the mean ± SEM (n WT = 87/9; n AnxA5-KO = 106/10). ( C ) Immunoblots show the expression level of AnxA5, <t>VDAC1,</t> MICU1, MICU2, UCP2, MCU, and EMRE in WT and AnxA5-KO HeLa cell lysates. Uncropped blots are provided in the Source data. ( D ) Bar graph shows the expression level analysis of the respective proteins. Data points represent the mean ± SEM (n WT = 3; n AnxA5-KO = 3). ( E ) Representative confocal images of WT and AnxA5-KO HeLa cells were captured, stained with MTR-CMX (magenta), and expressed ERAT4.03 NA (green). Multiplying the fluorescence signals of mitochondria and ER at the pixel level, and subsequently amplifying the resulting signal, led to the visualization of MAM. Images provide an overview of the cells (scale bar = 10 μm), and magnified views of selected regions indicated by dashed squares (scale bar = 1 μm). ( F ) Bar graphs show the ER-mitochondrial co-localization represented by Pearson’s R-value, ( G ) mitochondrial volume, and ( H ) mitochondrial branching (a lower value indicates more branched mitochondria). Data points represent the mean ± SEM (n WT = 91/11; n AnxA5-KO = 88/11). The p -values were calculated using a two-tailed unpaired Student’s t-test for ( F ), p = 0.8780 (ns); for ( G ), p = 0.0092 (** p < 0.01); and for ( H ), p = 0.0036 (** p < 0.01). ( I ) Representative TEM images of mitochondria in WT and AnxA5-KO HeLa cells, where mitochondria are highlighted with magenta (scale bar = 500 nm). ( J ) Bar graphs show the cristae membrane-amount, measured by calculating the perimeter of cristae and normalizing it to the corresponding perimeter of mitochondria, and ( K ) cristae density was calculated by normalizing the perimeter of cristae to the area of mitochondria. Data points represent the mean ± SEM (n WT = 47/2; n AnxA5-KO = 45/2), n represents the number of mitochondria/biological replicates). ( L ) Schematic illustration depicts the spatial cristae membrane density (ρCM) measurement within segmented mitochondria. Iterative measurements of ρCM density were conducted in gradually downsized circular segments. ( M ) shows the spatial ρCM distribution in WT and AnxA5-KO cells by using the methods depicted in ( L ). The x-axis scale ranges from 0 to 100, with 0 indicating the outermost shell of the mitochondrion and 100 representing the mitochondrial center. Data points represent the mean ± SEM (n WT = 44/3; n AnxA5-KO = 47/3). n represents the number of cells/biological replicates (minimum of 3 independent experiments). Significant differences were assessed with the unpaired Student’s t-test or Kolmogorov–Smirnov test (* p < 0.05, ** p < 0.01, and ns: not significant). .
    Vdac1 3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vdac1 3/product/Cell Signaling Technology Inc
    Average 97 stars, based on 1 article reviews
    vdac1 3 - by Bioz Stars, 2026-03
    97/100 stars
      Buy from Supplier

    90
    Sangon Biotech wt vdac1/2/3
    ( A ) Representative time courses of Ψmito before and after 1 μM FCCP treatment in WT (black) and AnxA5-KO (red) HeLa cells stained with TMRM. ( B ) Bar graph shows the relative mitochondrial membrane potential in WT (black) and AnxA5-KO (red) HeLa cells. Data points represent the mean ± SEM (n WT = 87/9; n AnxA5-KO = 106/10). ( C ) Immunoblots show the expression level of AnxA5, <t>VDAC1,</t> MICU1, MICU2, UCP2, MCU, and EMRE in WT and AnxA5-KO HeLa cell lysates. Uncropped blots are provided in the Source data. ( D ) Bar graph shows the expression level analysis of the respective proteins. Data points represent the mean ± SEM (n WT = 3; n AnxA5-KO = 3). ( E ) Representative confocal images of WT and AnxA5-KO HeLa cells were captured, stained with MTR-CMX (magenta), and expressed ERAT4.03 NA (green). Multiplying the fluorescence signals of mitochondria and ER at the pixel level, and subsequently amplifying the resulting signal, led to the visualization of MAM. Images provide an overview of the cells (scale bar = 10 μm), and magnified views of selected regions indicated by dashed squares (scale bar = 1 μm). ( F ) Bar graphs show the ER-mitochondrial co-localization represented by Pearson’s R-value, ( G ) mitochondrial volume, and ( H ) mitochondrial branching (a lower value indicates more branched mitochondria). Data points represent the mean ± SEM (n WT = 91/11; n AnxA5-KO = 88/11). The p -values were calculated using a two-tailed unpaired Student’s t-test for ( F ), p = 0.8780 (ns); for ( G ), p = 0.0092 (** p < 0.01); and for ( H ), p = 0.0036 (** p < 0.01). ( I ) Representative TEM images of mitochondria in WT and AnxA5-KO HeLa cells, where mitochondria are highlighted with magenta (scale bar = 500 nm). ( J ) Bar graphs show the cristae membrane-amount, measured by calculating the perimeter of cristae and normalizing it to the corresponding perimeter of mitochondria, and ( K ) cristae density was calculated by normalizing the perimeter of cristae to the area of mitochondria. Data points represent the mean ± SEM (n WT = 47/2; n AnxA5-KO = 45/2), n represents the number of mitochondria/biological replicates). ( L ) Schematic illustration depicts the spatial cristae membrane density (ρCM) measurement within segmented mitochondria. Iterative measurements of ρCM density were conducted in gradually downsized circular segments. ( M ) shows the spatial ρCM distribution in WT and AnxA5-KO cells by using the methods depicted in ( L ). The x-axis scale ranges from 0 to 100, with 0 indicating the outermost shell of the mitochondrion and 100 representing the mitochondrial center. Data points represent the mean ± SEM (n WT = 44/3; n AnxA5-KO = 47/3). n represents the number of cells/biological replicates (minimum of 3 independent experiments). Significant differences were assessed with the unpaired Student’s t-test or Kolmogorov–Smirnov test (* p < 0.05, ** p < 0.01, and ns: not significant). .
    Wt Vdac1/2/3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wt vdac1/2/3/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    wt vdac1/2/3 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Millipore vdac1 shrna sequence 3 accaggtatcaaactgacgttct
    ( A ) Representative time courses of Ψmito before and after 1 μM FCCP treatment in WT (black) and AnxA5-KO (red) HeLa cells stained with TMRM. ( B ) Bar graph shows the relative mitochondrial membrane potential in WT (black) and AnxA5-KO (red) HeLa cells. Data points represent the mean ± SEM (n WT = 87/9; n AnxA5-KO = 106/10). ( C ) Immunoblots show the expression level of AnxA5, <t>VDAC1,</t> MICU1, MICU2, UCP2, MCU, and EMRE in WT and AnxA5-KO HeLa cell lysates. Uncropped blots are provided in the Source data. ( D ) Bar graph shows the expression level analysis of the respective proteins. Data points represent the mean ± SEM (n WT = 3; n AnxA5-KO = 3). ( E ) Representative confocal images of WT and AnxA5-KO HeLa cells were captured, stained with MTR-CMX (magenta), and expressed ERAT4.03 NA (green). Multiplying the fluorescence signals of mitochondria and ER at the pixel level, and subsequently amplifying the resulting signal, led to the visualization of MAM. Images provide an overview of the cells (scale bar = 10 μm), and magnified views of selected regions indicated by dashed squares (scale bar = 1 μm). ( F ) Bar graphs show the ER-mitochondrial co-localization represented by Pearson’s R-value, ( G ) mitochondrial volume, and ( H ) mitochondrial branching (a lower value indicates more branched mitochondria). Data points represent the mean ± SEM (n WT = 91/11; n AnxA5-KO = 88/11). The p -values were calculated using a two-tailed unpaired Student’s t-test for ( F ), p = 0.8780 (ns); for ( G ), p = 0.0092 (** p < 0.01); and for ( H ), p = 0.0036 (** p < 0.01). ( I ) Representative TEM images of mitochondria in WT and AnxA5-KO HeLa cells, where mitochondria are highlighted with magenta (scale bar = 500 nm). ( J ) Bar graphs show the cristae membrane-amount, measured by calculating the perimeter of cristae and normalizing it to the corresponding perimeter of mitochondria, and ( K ) cristae density was calculated by normalizing the perimeter of cristae to the area of mitochondria. Data points represent the mean ± SEM (n WT = 47/2; n AnxA5-KO = 45/2), n represents the number of mitochondria/biological replicates). ( L ) Schematic illustration depicts the spatial cristae membrane density (ρCM) measurement within segmented mitochondria. Iterative measurements of ρCM density were conducted in gradually downsized circular segments. ( M ) shows the spatial ρCM distribution in WT and AnxA5-KO cells by using the methods depicted in ( L ). The x-axis scale ranges from 0 to 100, with 0 indicating the outermost shell of the mitochondrion and 100 representing the mitochondrial center. Data points represent the mean ± SEM (n WT = 44/3; n AnxA5-KO = 47/3). n represents the number of cells/biological replicates (minimum of 3 independent experiments). Significant differences were assessed with the unpaired Student’s t-test or Kolmogorov–Smirnov test (* p < 0.05, ** p < 0.01, and ns: not significant). .
    Vdac1 Shrna Sequence 3 Accaggtatcaaactgacgttct, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vdac1 shrna sequence 3 accaggtatcaaactgacgttct/product/Millipore
    Average 90 stars, based on 1 article reviews
    vdac1 shrna sequence 3 accaggtatcaaactgacgttct - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    86
    Danaher Inc anti vdac1 3
    ( a-d ) Proximity ligation assay (PLA) using anti-pan-IP 3 R, and <t>anti-VDAC1/3</t> antibody (green) of HeLa cells expressing control plasmid (ER-mRFP) and ER-mitochondrial linkers (EMLs) (red). ( a ) Cartoon illustrating that only IP 3 Rs and VDAC1/3 juxta-positioned at ≤ 40 nm are labelled. Representative images ( b ) and quantification of the PLA-labelled area intensity of and PLA-EML Pearson colocalization coefficient ( d ). Scale bars = 20 µM. ( e-g ) Immunofluorescent analysis using anti-pan-IP 3 R antibody (green) in ER-mRFP and EML-expressing HeLa cells (red). ( e ) Cartoon illustrating that all IP 3 Rs present in the cells are labelled. Representative images ( f ) and quantification of IP 3 R-EML Pearson colocalization coefficient ( g ). Scale bars = 20 µM. ( h-j ) Localization of endogenous IP 3 R1 tagged with EGFP in HeLa cells (endogenous IP 3 R1-EGFP, green) upon expression of ER-EBFP, and 10nm- and 20nm-EMLs containing EBFP (magenta). ( h ) Cartoon illustrating that all endogenous IP 3 R1 receptors are tagged with EGFP. Representative images ( i ) and quantification of EGFP-EML Pearson colocalization coefficient ( j ). Scale bars = 20 µM. Whisker plots report data collected from 54-106 ( c ), 25-30 ( d ), 8-18 ( g ), 16-18 ( j ) cells from at least 3 independent coverslips analyzed from 3 independent cultures. One-way ANOVA, Tukey post hoc test. ** p < 0.01, *** p < 0.001, **** p < 0.0001. Representative images ( K ) and quantification of total cell lysates ( l ) and isolated MERCS ( m ) using anti-pan-IP 3 R antibody, anti-VDAC1/3 or anti-GRP75 antibody. Data are expressed as mean ± SEM of n = 3 independent experiments. Unpaired two-tailed Student’s t-test. **, p < 0.01.
    Anti Vdac1 3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti vdac1 3/product/Danaher Inc
    Average 86 stars, based on 1 article reviews
    anti vdac1 3 - by Bioz Stars, 2026-03
    86/100 stars
      Buy from Supplier

    97
    Proteintech vdac1
    ( a-d ) Proximity ligation assay (PLA) using anti-pan-IP 3 R, and <t>anti-VDAC1/3</t> antibody (green) of HeLa cells expressing control plasmid (ER-mRFP) and ER-mitochondrial linkers (EMLs) (red). ( a ) Cartoon illustrating that only IP 3 Rs and VDAC1/3 juxta-positioned at ≤ 40 nm are labelled. Representative images ( b ) and quantification of the PLA-labelled area intensity of and PLA-EML Pearson colocalization coefficient ( d ). Scale bars = 20 µM. ( e-g ) Immunofluorescent analysis using anti-pan-IP 3 R antibody (green) in ER-mRFP and EML-expressing HeLa cells (red). ( e ) Cartoon illustrating that all IP 3 Rs present in the cells are labelled. Representative images ( f ) and quantification of IP 3 R-EML Pearson colocalization coefficient ( g ). Scale bars = 20 µM. ( h-j ) Localization of endogenous IP 3 R1 tagged with EGFP in HeLa cells (endogenous IP 3 R1-EGFP, green) upon expression of ER-EBFP, and 10nm- and 20nm-EMLs containing EBFP (magenta). ( h ) Cartoon illustrating that all endogenous IP 3 R1 receptors are tagged with EGFP. Representative images ( i ) and quantification of EGFP-EML Pearson colocalization coefficient ( j ). Scale bars = 20 µM. Whisker plots report data collected from 54-106 ( c ), 25-30 ( d ), 8-18 ( g ), 16-18 ( j ) cells from at least 3 independent coverslips analyzed from 3 independent cultures. One-way ANOVA, Tukey post hoc test. ** p < 0.01, *** p < 0.001, **** p < 0.0001. Representative images ( K ) and quantification of total cell lysates ( l ) and isolated MERCS ( m ) using anti-pan-IP 3 R antibody, anti-VDAC1/3 or anti-GRP75 antibody. Data are expressed as mean ± SEM of n = 3 independent experiments. Unpaired two-tailed Student’s t-test. **, p < 0.01.
    Vdac1, supplied by Proteintech, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vdac1/product/Proteintech
    Average 97 stars, based on 1 article reviews
    vdac1 - by Bioz Stars, 2026-03
    97/100 stars
      Buy from Supplier

    86
    Danaher Inc vdac1 3
    ( a-d ) Proximity ligation assay (PLA) using anti-pan-IP 3 R, and <t>anti-VDAC1/3</t> antibody (green) of HeLa cells expressing control plasmid (ER-mRFP) and ER-mitochondrial linkers (EMLs) (red). ( a ) Cartoon illustrating that only IP 3 Rs and VDAC1/3 juxta-positioned at ≤ 40 nm are labelled. Representative images ( b ) and quantification of the PLA-labelled area intensity of and PLA-EML Pearson colocalization coefficient ( d ). Scale bars = 20 µM. ( e-g ) Immunofluorescent analysis using anti-pan-IP 3 R antibody (green) in ER-mRFP and EML-expressing HeLa cells (red). ( e ) Cartoon illustrating that all IP 3 Rs present in the cells are labelled. Representative images ( f ) and quantification of IP 3 R-EML Pearson colocalization coefficient ( g ). Scale bars = 20 µM. ( h-j ) Localization of endogenous IP 3 R1 tagged with EGFP in HeLa cells (endogenous IP 3 R1-EGFP, green) upon expression of ER-EBFP, and 10nm- and 20nm-EMLs containing EBFP (magenta). ( h ) Cartoon illustrating that all endogenous IP 3 R1 receptors are tagged with EGFP. Representative images ( i ) and quantification of EGFP-EML Pearson colocalization coefficient ( j ). Scale bars = 20 µM. Whisker plots report data collected from 54-106 ( c ), 25-30 ( d ), 8-18 ( g ), 16-18 ( j ) cells from at least 3 independent coverslips analyzed from 3 independent cultures. One-way ANOVA, Tukey post hoc test. ** p < 0.01, *** p < 0.001, **** p < 0.0001. Representative images ( K ) and quantification of total cell lysates ( l ) and isolated MERCS ( m ) using anti-pan-IP 3 R antibody, anti-VDAC1/3 or anti-GRP75 antibody. Data are expressed as mean ± SEM of n = 3 independent experiments. Unpaired two-tailed Student’s t-test. **, p < 0.01.
    Vdac1 3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vdac1 3/product/Danaher Inc
    Average 86 stars, based on 1 article reviews
    vdac1 3 - by Bioz Stars, 2026-03
    86/100 stars
      Buy from Supplier

    90
    Santa Cruz Biotechnology rabbit polyclonal anti-vdac1/2/3
    ( a-d ) Proximity ligation assay (PLA) using anti-pan-IP 3 R, and <t>anti-VDAC1/3</t> antibody (green) of HeLa cells expressing control plasmid (ER-mRFP) and ER-mitochondrial linkers (EMLs) (red). ( a ) Cartoon illustrating that only IP 3 Rs and VDAC1/3 juxta-positioned at ≤ 40 nm are labelled. Representative images ( b ) and quantification of the PLA-labelled area intensity of and PLA-EML Pearson colocalization coefficient ( d ). Scale bars = 20 µM. ( e-g ) Immunofluorescent analysis using anti-pan-IP 3 R antibody (green) in ER-mRFP and EML-expressing HeLa cells (red). ( e ) Cartoon illustrating that all IP 3 Rs present in the cells are labelled. Representative images ( f ) and quantification of IP 3 R-EML Pearson colocalization coefficient ( g ). Scale bars = 20 µM. ( h-j ) Localization of endogenous IP 3 R1 tagged with EGFP in HeLa cells (endogenous IP 3 R1-EGFP, green) upon expression of ER-EBFP, and 10nm- and 20nm-EMLs containing EBFP (magenta). ( h ) Cartoon illustrating that all endogenous IP 3 R1 receptors are tagged with EGFP. Representative images ( i ) and quantification of EGFP-EML Pearson colocalization coefficient ( j ). Scale bars = 20 µM. Whisker plots report data collected from 54-106 ( c ), 25-30 ( d ), 8-18 ( g ), 16-18 ( j ) cells from at least 3 independent coverslips analyzed from 3 independent cultures. One-way ANOVA, Tukey post hoc test. ** p < 0.01, *** p < 0.001, **** p < 0.0001. Representative images ( K ) and quantification of total cell lysates ( l ) and isolated MERCS ( m ) using anti-pan-IP 3 R antibody, anti-VDAC1/3 or anti-GRP75 antibody. Data are expressed as mean ± SEM of n = 3 independent experiments. Unpaired two-tailed Student’s t-test. **, p < 0.01.
    Rabbit Polyclonal Anti Vdac1/2/3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit polyclonal anti-vdac1/2/3/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    rabbit polyclonal anti-vdac1/2/3 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    ( A ) Representative time courses of Ψmito before and after 1 μM FCCP treatment in WT (black) and AnxA5-KO (red) HeLa cells stained with TMRM. ( B ) Bar graph shows the relative mitochondrial membrane potential in WT (black) and AnxA5-KO (red) HeLa cells. Data points represent the mean ± SEM (n WT = 87/9; n AnxA5-KO = 106/10). ( C ) Immunoblots show the expression level of AnxA5, VDAC1, MICU1, MICU2, UCP2, MCU, and EMRE in WT and AnxA5-KO HeLa cell lysates. Uncropped blots are provided in the Source data. ( D ) Bar graph shows the expression level analysis of the respective proteins. Data points represent the mean ± SEM (n WT = 3; n AnxA5-KO = 3). ( E ) Representative confocal images of WT and AnxA5-KO HeLa cells were captured, stained with MTR-CMX (magenta), and expressed ERAT4.03 NA (green). Multiplying the fluorescence signals of mitochondria and ER at the pixel level, and subsequently amplifying the resulting signal, led to the visualization of MAM. Images provide an overview of the cells (scale bar = 10 μm), and magnified views of selected regions indicated by dashed squares (scale bar = 1 μm). ( F ) Bar graphs show the ER-mitochondrial co-localization represented by Pearson’s R-value, ( G ) mitochondrial volume, and ( H ) mitochondrial branching (a lower value indicates more branched mitochondria). Data points represent the mean ± SEM (n WT = 91/11; n AnxA5-KO = 88/11). The p -values were calculated using a two-tailed unpaired Student’s t-test for ( F ), p = 0.8780 (ns); for ( G ), p = 0.0092 (** p < 0.01); and for ( H ), p = 0.0036 (** p < 0.01). ( I ) Representative TEM images of mitochondria in WT and AnxA5-KO HeLa cells, where mitochondria are highlighted with magenta (scale bar = 500 nm). ( J ) Bar graphs show the cristae membrane-amount, measured by calculating the perimeter of cristae and normalizing it to the corresponding perimeter of mitochondria, and ( K ) cristae density was calculated by normalizing the perimeter of cristae to the area of mitochondria. Data points represent the mean ± SEM (n WT = 47/2; n AnxA5-KO = 45/2), n represents the number of mitochondria/biological replicates). ( L ) Schematic illustration depicts the spatial cristae membrane density (ρCM) measurement within segmented mitochondria. Iterative measurements of ρCM density were conducted in gradually downsized circular segments. ( M ) shows the spatial ρCM distribution in WT and AnxA5-KO cells by using the methods depicted in ( L ). The x-axis scale ranges from 0 to 100, with 0 indicating the outermost shell of the mitochondrion and 100 representing the mitochondrial center. Data points represent the mean ± SEM (n WT = 44/3; n AnxA5-KO = 47/3). n represents the number of cells/biological replicates (minimum of 3 independent experiments). Significant differences were assessed with the unpaired Student’s t-test or Kolmogorov–Smirnov test (* p < 0.05, ** p < 0.01, and ns: not significant). .

    Journal: The EMBO Journal

    Article Title: Annexin A5 controls VDAC1-dependent mitochondrial Ca 2+ homeostasis and determines cellular susceptibility to apoptosis

    doi: 10.1038/s44318-025-00454-9

    Figure Lengend Snippet: ( A ) Representative time courses of Ψmito before and after 1 μM FCCP treatment in WT (black) and AnxA5-KO (red) HeLa cells stained with TMRM. ( B ) Bar graph shows the relative mitochondrial membrane potential in WT (black) and AnxA5-KO (red) HeLa cells. Data points represent the mean ± SEM (n WT = 87/9; n AnxA5-KO = 106/10). ( C ) Immunoblots show the expression level of AnxA5, VDAC1, MICU1, MICU2, UCP2, MCU, and EMRE in WT and AnxA5-KO HeLa cell lysates. Uncropped blots are provided in the Source data. ( D ) Bar graph shows the expression level analysis of the respective proteins. Data points represent the mean ± SEM (n WT = 3; n AnxA5-KO = 3). ( E ) Representative confocal images of WT and AnxA5-KO HeLa cells were captured, stained with MTR-CMX (magenta), and expressed ERAT4.03 NA (green). Multiplying the fluorescence signals of mitochondria and ER at the pixel level, and subsequently amplifying the resulting signal, led to the visualization of MAM. Images provide an overview of the cells (scale bar = 10 μm), and magnified views of selected regions indicated by dashed squares (scale bar = 1 μm). ( F ) Bar graphs show the ER-mitochondrial co-localization represented by Pearson’s R-value, ( G ) mitochondrial volume, and ( H ) mitochondrial branching (a lower value indicates more branched mitochondria). Data points represent the mean ± SEM (n WT = 91/11; n AnxA5-KO = 88/11). The p -values were calculated using a two-tailed unpaired Student’s t-test for ( F ), p = 0.8780 (ns); for ( G ), p = 0.0092 (** p < 0.01); and for ( H ), p = 0.0036 (** p < 0.01). ( I ) Representative TEM images of mitochondria in WT and AnxA5-KO HeLa cells, where mitochondria are highlighted with magenta (scale bar = 500 nm). ( J ) Bar graphs show the cristae membrane-amount, measured by calculating the perimeter of cristae and normalizing it to the corresponding perimeter of mitochondria, and ( K ) cristae density was calculated by normalizing the perimeter of cristae to the area of mitochondria. Data points represent the mean ± SEM (n WT = 47/2; n AnxA5-KO = 45/2), n represents the number of mitochondria/biological replicates). ( L ) Schematic illustration depicts the spatial cristae membrane density (ρCM) measurement within segmented mitochondria. Iterative measurements of ρCM density were conducted in gradually downsized circular segments. ( M ) shows the spatial ρCM distribution in WT and AnxA5-KO cells by using the methods depicted in ( L ). The x-axis scale ranges from 0 to 100, with 0 indicating the outermost shell of the mitochondrion and 100 representing the mitochondrial center. Data points represent the mean ± SEM (n WT = 44/3; n AnxA5-KO = 47/3). n represents the number of cells/biological replicates (minimum of 3 independent experiments). Significant differences were assessed with the unpaired Student’s t-test or Kolmogorov–Smirnov test (* p < 0.05, ** p < 0.01, and ns: not significant). .

    Article Snippet: VDAC1 siRNA (5′-3′) ACACUAGGCACCGAGAUUA , Microsynth , Waldeck-Weiermair et al ( ) (Front Cell Neurosci) .

    Techniques: Staining, Membrane, Western Blot, Expressing, Fluorescence, Two Tailed Test

    ( A ) Representative immunoblots show protein components of subcellular fractions including Homogenate (Homog), cytosol (Cyto), crude mitochondria (C. Mito), and pure mitochondria (P. Mito) obtained from HeLa cells. Marker proteins indicate OMM (VDAC1), the cytosolic leaflet of the OMM (TOM20), IMS (cytochrome-C, Cyt-C), and cytosol (tubulin). To digest proteins localized on the cytosolic leaflet of the OMM, the pure mitochondrial fraction was incubated with 50 µg/ml Proteinase K (PK) for 15 min ( n = 3). Uncropped blots are provided in the Source Data. ( B ) Representative Immuno-electron micrographs of mitochondria from HeLa cells. In the upper panel, individual gold particles indicate the localization of the AnxA5, while the lower panel serves as a negative control where the primary antibody was omitted. Mitochondria were highlighted with magenta and individual gold particles were marked with green arrows (scale bar = 250 nm). ( C ) Representative time courses of the 100 μM histamine-induced [Ca 2+ ] IMS responses in WT (black) and AnxA5-KO (red) in HeLa cells measured in Ca 2+ (2 mM) containing buffer. ( D ) Bar graphs show the histamine-induced maximum [Ca 2+ ] IMS levels in WT (black) and AnxA5-KO (red). Data points represent the mean ± SEM (n WT = 23/7; n AnxA5-KO = 34/8). The p -value was calculated using the two-tailed Kolmogorov–Smirnov test, yielding p < 0.0001 (**** p < 0.0001). ( E ) Mean time courses of the 100 μM histamine-induced [Ca 2+ ] IMS responses of WT (black) and AnxA5-KO (red) EA.hy926 cells measured in Ca 2+ -free buffer (containing 100 μM of EGTA). ( F ) Bar graph shows the histamine-induced maximum [Ca 2+ ] IMS levels in WT (black) and AnxA5-KO (red) cells. Data points represent the mean ± SEM (n WT = 14/6; n AnxA5-KO = 12/6). The p -value was calculated using a two-tailed unpaired Student’s t-test, p = 0.0034 (** p < 0.01). ( G ) Mean time courses of 15 μM BHQ and 100 μM histamine-induced [Ca 2+ ] IMS responses in the absence of extracellular Ca 2+ and upon subsequent store-operated Ca 2+ entry in WT (black) and AnxA5-KO (red) HeLa cells. ( H ) Bar graphs show the BHQ-, ( I ) histamine-, and ( J ) SOCE-induced maximum [Ca 2+ ] IMS responses in WT (black) and AnxA5-KO (red) cells. Data points represent the mean ± SEM (n WT = 23/5; n AnxA5-KO = 16/4). The p -value for ( I ) was calculated using a two-tailed unpaired t-test yielding p = 0.001 (** p < 0.01). ( K ) Table displaying the list of AnxA5 mutation sites and the characteristics of the mutations. L Average time courses of 100 μM ATP-induced [Ca 2+ ] IMS responses were measured in HeLa cells under Ca 2+ -free conditions (containing 100 μM of EGTA). Studied cell groups: WT, AnxA5-KO, AnxA5-KO + AnxA5 (WT AnxA5), AnxA5-KO + AnxA5-2Mt (mutations in the Ca 2+ -binding domain: D144N, E228Q), AnxA5-KO + AnxA5-3Mt (mutations in the Ca 2+ -binding domain: D144N, E228Q, D303N), AnxA5-KO + AnxA5-5Mt (mutations in the self-assembly domain: R18E, R25E, K29E, K58E, K193). Cells were transfected with either an empty plasmid in WT and AnxA5-KO cells or the respective WT or mutant version of AnxA5 in AnxA5-KO cells. ( M ) Bar graphs show the ATP-induced maximum [Ca 2+ ] IMS levels in WT (black), AnxA5-KO (red), AnxA5-KO + AnxA5 (blue), AnxA5-KO + AnxA5-2Mt (orange), AnxA5-KO + AnxA5-3Mt (magenta), AnxA5-KO + AnxA5-5Mt (green). Data points represent the mean ± SEM (n WT = 53/10; n AnxA5-KO = 67/12; n Rescue = 64/11; n AnxA5-KO+2Mt = 55/11; n AnxA5-KO+3Mt = 58/11; n AnxA5-KO+5Mt = 60/12). n represents the number of cells/biological replicates (minimum of 3 independent experiments). The p -values were calculated using a Kruskal–Wallis test, from left to right: p = 0.0011 (** p < 0.01), p < 0.0001 (**** p < 0.0001), p = 0.1488 (ns), p = 0.9038 (ns), p < 0.0001 (**** p < 0.0001). Significant differences were assessed using either one-way ANOVA with Kruskal–Wallis test (** p < 0.01, **** p < 0.0001 and ns: not significant) and with the unpaired Student’s t-test or Kolmogorov–Smirnov test (** p < 0.01, **** p < 0.0001 and ns: not significant). .

    Journal: The EMBO Journal

    Article Title: Annexin A5 controls VDAC1-dependent mitochondrial Ca 2+ homeostasis and determines cellular susceptibility to apoptosis

    doi: 10.1038/s44318-025-00454-9

    Figure Lengend Snippet: ( A ) Representative immunoblots show protein components of subcellular fractions including Homogenate (Homog), cytosol (Cyto), crude mitochondria (C. Mito), and pure mitochondria (P. Mito) obtained from HeLa cells. Marker proteins indicate OMM (VDAC1), the cytosolic leaflet of the OMM (TOM20), IMS (cytochrome-C, Cyt-C), and cytosol (tubulin). To digest proteins localized on the cytosolic leaflet of the OMM, the pure mitochondrial fraction was incubated with 50 µg/ml Proteinase K (PK) for 15 min ( n = 3). Uncropped blots are provided in the Source Data. ( B ) Representative Immuno-electron micrographs of mitochondria from HeLa cells. In the upper panel, individual gold particles indicate the localization of the AnxA5, while the lower panel serves as a negative control where the primary antibody was omitted. Mitochondria were highlighted with magenta and individual gold particles were marked with green arrows (scale bar = 250 nm). ( C ) Representative time courses of the 100 μM histamine-induced [Ca 2+ ] IMS responses in WT (black) and AnxA5-KO (red) in HeLa cells measured in Ca 2+ (2 mM) containing buffer. ( D ) Bar graphs show the histamine-induced maximum [Ca 2+ ] IMS levels in WT (black) and AnxA5-KO (red). Data points represent the mean ± SEM (n WT = 23/7; n AnxA5-KO = 34/8). The p -value was calculated using the two-tailed Kolmogorov–Smirnov test, yielding p < 0.0001 (**** p < 0.0001). ( E ) Mean time courses of the 100 μM histamine-induced [Ca 2+ ] IMS responses of WT (black) and AnxA5-KO (red) EA.hy926 cells measured in Ca 2+ -free buffer (containing 100 μM of EGTA). ( F ) Bar graph shows the histamine-induced maximum [Ca 2+ ] IMS levels in WT (black) and AnxA5-KO (red) cells. Data points represent the mean ± SEM (n WT = 14/6; n AnxA5-KO = 12/6). The p -value was calculated using a two-tailed unpaired Student’s t-test, p = 0.0034 (** p < 0.01). ( G ) Mean time courses of 15 μM BHQ and 100 μM histamine-induced [Ca 2+ ] IMS responses in the absence of extracellular Ca 2+ and upon subsequent store-operated Ca 2+ entry in WT (black) and AnxA5-KO (red) HeLa cells. ( H ) Bar graphs show the BHQ-, ( I ) histamine-, and ( J ) SOCE-induced maximum [Ca 2+ ] IMS responses in WT (black) and AnxA5-KO (red) cells. Data points represent the mean ± SEM (n WT = 23/5; n AnxA5-KO = 16/4). The p -value for ( I ) was calculated using a two-tailed unpaired t-test yielding p = 0.001 (** p < 0.01). ( K ) Table displaying the list of AnxA5 mutation sites and the characteristics of the mutations. L Average time courses of 100 μM ATP-induced [Ca 2+ ] IMS responses were measured in HeLa cells under Ca 2+ -free conditions (containing 100 μM of EGTA). Studied cell groups: WT, AnxA5-KO, AnxA5-KO + AnxA5 (WT AnxA5), AnxA5-KO + AnxA5-2Mt (mutations in the Ca 2+ -binding domain: D144N, E228Q), AnxA5-KO + AnxA5-3Mt (mutations in the Ca 2+ -binding domain: D144N, E228Q, D303N), AnxA5-KO + AnxA5-5Mt (mutations in the self-assembly domain: R18E, R25E, K29E, K58E, K193). Cells were transfected with either an empty plasmid in WT and AnxA5-KO cells or the respective WT or mutant version of AnxA5 in AnxA5-KO cells. ( M ) Bar graphs show the ATP-induced maximum [Ca 2+ ] IMS levels in WT (black), AnxA5-KO (red), AnxA5-KO + AnxA5 (blue), AnxA5-KO + AnxA5-2Mt (orange), AnxA5-KO + AnxA5-3Mt (magenta), AnxA5-KO + AnxA5-5Mt (green). Data points represent the mean ± SEM (n WT = 53/10; n AnxA5-KO = 67/12; n Rescue = 64/11; n AnxA5-KO+2Mt = 55/11; n AnxA5-KO+3Mt = 58/11; n AnxA5-KO+5Mt = 60/12). n represents the number of cells/biological replicates (minimum of 3 independent experiments). The p -values were calculated using a Kruskal–Wallis test, from left to right: p = 0.0011 (** p < 0.01), p < 0.0001 (**** p < 0.0001), p = 0.1488 (ns), p = 0.9038 (ns), p < 0.0001 (**** p < 0.0001). Significant differences were assessed using either one-way ANOVA with Kruskal–Wallis test (** p < 0.01, **** p < 0.0001 and ns: not significant) and with the unpaired Student’s t-test or Kolmogorov–Smirnov test (** p < 0.01, **** p < 0.0001 and ns: not significant). .

    Article Snippet: VDAC1 siRNA (5′-3′) ACACUAGGCACCGAGAUUA , Microsynth , Waldeck-Weiermair et al ( ) (Front Cell Neurosci) .

    Techniques: Western Blot, Marker, Incubation, Negative Control, Two Tailed Test, Mutagenesis, Binding Assay, Transfection, Plasmid Preparation

    ( A ) Representative image of PLA assay indicating the protein-protein proximity between AnxA5 and VDAC1 in siNeg- and siVDAC1-treated WT, and in AnxA5-KO HeLa cells (scale bar = 20 μm). ( B ) The bar graph shows the ratio of total PLA signals to the number of cells. Data points represent the mean ± SEM (n siNeg = 4; n siVDAC1 = 3; n AnxA5-KO = 4). The p -values were calculated using a Kruskal–Wallis test, from left to right: p = 0.0025 (** p < 0.01), p < 0.0001 (**** p < 0.0001), and p = 0.2271 (ns). ( C ) Representative time courses of 100 μM histamine-induced [Ca 2+ ] Matrix responses in WT_siNeg, AnxA5-KO_siNeg, WT_siVDAC1, AnxA5-KO_siVDAC1, WT_siVDAC1 + VDAC2-FLAG, AnxA5-KO_siVDAC1 + VDAC2-FLAG, WT_siVDAC1 + VDAC3-FLAG, and AnxA5-KO_siVDAC1 + VDAC3-FLAG were measured in a Ca 2+ (2 mM)-containing buffer. ( D ) Bar graphs show the histamine-induced maximum [Ca 2+ ] Matrix levels in WT_siNeg (black), AnxA5-KO_siNeg (red), WT_siVDAC1 (dark yellow), AnxA5-KO_siVDAC1 (orange), WT_siVDAC1 + VDAC2-FLAG (green), AnxA5-KO_siVDAC1 + VDAC2-FLAG (blue), WT_siVDAC1 + VDAC3-FLAG (gray), and AnxA5-KO_siVDAC1 + VDAC3-FLAG (brown). Data points represent the mean ± SEM (n WT_siNeg = 40/9; n AnxA5-KO_siNeg = 47/9; n WT_siVDAC1 = 44/9; n AnxA5-KO_siVDAC1 = 43/7; n WT_siVDAC1+VDAC2-FLAG = 42/6; n AnxA5-KO_siVDAC1+VDAC2-FLAG = 43/8; n WT_siVDAC1+VDAC3-FLAG = 50/7; n AnxA5-KO_siVDAC1+VDAC3-FLAG = 48/8). The p-values were calculated using a Kruskal–Wallis test, from left to right (bottom to top): p = 0.0014 (** p < 0.01), p < 0.0001 (**** p < 0.0001), p = 0.1353 (ns), p = 0.0401, * p < 0.05), p > 0.9999 (ns) and p > 0.9999 (ns). ( E ) The distribution of AnxA5-labeled gold particles within the whole cell was analyzed, showing their localization on mitochondria and cytosol under basal conditions (green) and 20 s after histamine stimulation (magenta). Positive values indicate the distance of the gold particles from the OMM to the mitochondrial matrix side, while negative values represent the distance from the OMM to the cytosol. Data points represent the subcellular localization of the gold particles (n WT-Basal = 10/3; n WT-Histamine = 10/3). ( F ) The relative occurrence of the gold particles was calculated based on the data presented in Fig. 5 ( E ). n represents the number of cells/biological replicates (minimum of 3 independent experiments). ( G ) The schematic illustration depicts the basal localization and histamine-induced translocation of AnxA5 to OMM. Significant differences were assessed using one-way ANOVA with Kruskal–Wallis test (* p < 0.05, ** p < 0.01, **** p < 0.0001 and ns: not significant). .

    Journal: The EMBO Journal

    Article Title: Annexin A5 controls VDAC1-dependent mitochondrial Ca 2+ homeostasis and determines cellular susceptibility to apoptosis

    doi: 10.1038/s44318-025-00454-9

    Figure Lengend Snippet: ( A ) Representative image of PLA assay indicating the protein-protein proximity between AnxA5 and VDAC1 in siNeg- and siVDAC1-treated WT, and in AnxA5-KO HeLa cells (scale bar = 20 μm). ( B ) The bar graph shows the ratio of total PLA signals to the number of cells. Data points represent the mean ± SEM (n siNeg = 4; n siVDAC1 = 3; n AnxA5-KO = 4). The p -values were calculated using a Kruskal–Wallis test, from left to right: p = 0.0025 (** p < 0.01), p < 0.0001 (**** p < 0.0001), and p = 0.2271 (ns). ( C ) Representative time courses of 100 μM histamine-induced [Ca 2+ ] Matrix responses in WT_siNeg, AnxA5-KO_siNeg, WT_siVDAC1, AnxA5-KO_siVDAC1, WT_siVDAC1 + VDAC2-FLAG, AnxA5-KO_siVDAC1 + VDAC2-FLAG, WT_siVDAC1 + VDAC3-FLAG, and AnxA5-KO_siVDAC1 + VDAC3-FLAG were measured in a Ca 2+ (2 mM)-containing buffer. ( D ) Bar graphs show the histamine-induced maximum [Ca 2+ ] Matrix levels in WT_siNeg (black), AnxA5-KO_siNeg (red), WT_siVDAC1 (dark yellow), AnxA5-KO_siVDAC1 (orange), WT_siVDAC1 + VDAC2-FLAG (green), AnxA5-KO_siVDAC1 + VDAC2-FLAG (blue), WT_siVDAC1 + VDAC3-FLAG (gray), and AnxA5-KO_siVDAC1 + VDAC3-FLAG (brown). Data points represent the mean ± SEM (n WT_siNeg = 40/9; n AnxA5-KO_siNeg = 47/9; n WT_siVDAC1 = 44/9; n AnxA5-KO_siVDAC1 = 43/7; n WT_siVDAC1+VDAC2-FLAG = 42/6; n AnxA5-KO_siVDAC1+VDAC2-FLAG = 43/8; n WT_siVDAC1+VDAC3-FLAG = 50/7; n AnxA5-KO_siVDAC1+VDAC3-FLAG = 48/8). The p-values were calculated using a Kruskal–Wallis test, from left to right (bottom to top): p = 0.0014 (** p < 0.01), p < 0.0001 (**** p < 0.0001), p = 0.1353 (ns), p = 0.0401, * p < 0.05), p > 0.9999 (ns) and p > 0.9999 (ns). ( E ) The distribution of AnxA5-labeled gold particles within the whole cell was analyzed, showing their localization on mitochondria and cytosol under basal conditions (green) and 20 s after histamine stimulation (magenta). Positive values indicate the distance of the gold particles from the OMM to the mitochondrial matrix side, while negative values represent the distance from the OMM to the cytosol. Data points represent the subcellular localization of the gold particles (n WT-Basal = 10/3; n WT-Histamine = 10/3). ( F ) The relative occurrence of the gold particles was calculated based on the data presented in Fig. 5 ( E ). n represents the number of cells/biological replicates (minimum of 3 independent experiments). ( G ) The schematic illustration depicts the basal localization and histamine-induced translocation of AnxA5 to OMM. Significant differences were assessed using one-way ANOVA with Kruskal–Wallis test (* p < 0.05, ** p < 0.01, **** p < 0.0001 and ns: not significant). .

    Article Snippet: VDAC1 siRNA (5′-3′) ACACUAGGCACCGAGAUUA , Microsynth , Waldeck-Weiermair et al ( ) (Front Cell Neurosci) .

    Techniques: Labeling, Translocation Assay

    ( A ) Bar graphs show the basal [Ca 2+ ] Matrix , ( B ) [Ca 2+ ] IMS, and ( C ) [Ca 2+ ] Cyto level in WT (black) and AnxA5-KO (red) cells upon 12 h DMSO, 5 μM and 10 μM cisplatin treatment. Data points represent the mean ± SEM for [Ca 2+ ] Matrix (n WT-DMSO = 63/6; n AnxA5-KO-DMSO = 75/6, n WT-5μM-cisplatin = 67/6; n AnxA5-KO-5μM-cisplatin = 71/6, n WT-10μM-cisplatin = 53/6; n AnxA5-KO-10μM-cisplatin = 54/6), and for [Ca 2+ ] IMS (n WT-DMSO = 64/6; n AnxA5-KO-DMSO = 66/6, n WT-5μM-cisplatin = 60/6; n AnxA5-KO-5μM-cisplatin = 74/6, n WT-10μM-cisplatin = 64/6; n AnxA5-KO-10μM-cisplatin = 63/6), and [Ca 2+ ] Cyto (n WT-DMSO = 64/6; n AnxA5-KO-DMSO = 68/6, n WT-5μM-cisplatin = 74/6; n AnxA5-KO-5μM-cisplatin = 84/6, n WT-10μM-cisplatin = 55/6; n AnxA5-KO-10μM-cisplatin = 83/6). The p -values for ( A ), from left to right, are: p = 0.3780 (ns), p = 0.0320 (* p < 0.05), and p = 0.0022 (** p < 0.01); for ( B ): p = 0.9716 (ns), p = 0.0640 (ns), and p = 0.0039 (** p < 0.01). ( D ) Bar graphs show the percentage of living cells and ( E ) late apoptosis, assessed by Annexin5-FITC/PI staining and FACS analysis in WT (black) and AnxA5-KO (red) cells upon 24 h DMSO, 5 μM and 10 μM cisplatin treatment. ( F ) Bar graphs show the percentage of living cells and ( G ) late apoptosis in WT (black) and AnxA5-KO (red) cells upon 24 h DMSO, 20 μM VBIT-4, 10 μM cisplatin, and cisplatin+VBIT-4 treatment. Data points represent the mean ± SEM (n WT-DMSO = 5; n AnxA5-KO-DMSO = 6, n WT-20μM-VBIT-4 = 6; n AnxA5-KO-20μM-VBIT-4 = 6, n WT-10μM-cisplatin = 6; n AnxA5-KO-10μM-cisplatin = 6, n WT-cisplatin+VBIT-4 = 6; n AnxA5-KO-cisplatin+VBIT-4 = 6). The p -values for ( D ), from left to right, are: p = 0.1775 (ns), p = 0.0043 (** p < 0.01), and p = 0.0095 (** p < 0.01); for ( E ): p = 0.6040 (ns), p = 0.0028 (** p < 0.01), and p < 0.0001 (**** p < 0.0001); for ( F ): p = 0.6787 (ns), p = 0.0582 (ns), p = 0.0037 (** p < 0.01), and p < 0.0001 (**** p < 0.0001); for ( G ): p = 0.8063 (ns), p = 0.1840 (ns), p < 0.0001 (**** p < 0.0001), and p < 0.0001 (**** p < 0.0001). ( H ) Representative immunoblot shows monomeric and dimeric VDAC1 levels. Uncropped blots are provided in the Source Data. ( I ) Bar graph shows the quantification of the immunoblot in WT (black) and AnxA5-KO (red) cells upon 48 h DMSO, 20 μM VBIT-4, 10 μM cisplatin, and cisplatin+VBIT-4 treatment (each color represents the experiments from the same day). Data points represent the mean ± SEM (n WT-all = 4; n AnxA5-KO-all = 4). The p -values, from left to right, are: p = 0.0003 (*** p < 0.001), p = 0.0037 (** p < 0.01), p = 0.0001 (*** p < 0.001), and p = 0.0005 (*** p < 0.001). n represents the number of cells/biological replicates (minimum of 3 independent experiments). Significant differences were assessed using either one-way ANOVA with Tukey’s multiple comparison tests (** p < 0.01, *** p < 0.001 and ns: not significant) and with the two-tailed unpaired Student’s t-test or Kolmogorov–Smirnov test (* p < 0.05, ** p < 0.01, **** p < 0.0001 and ns: not significant). .

    Journal: The EMBO Journal

    Article Title: Annexin A5 controls VDAC1-dependent mitochondrial Ca 2+ homeostasis and determines cellular susceptibility to apoptosis

    doi: 10.1038/s44318-025-00454-9

    Figure Lengend Snippet: ( A ) Bar graphs show the basal [Ca 2+ ] Matrix , ( B ) [Ca 2+ ] IMS, and ( C ) [Ca 2+ ] Cyto level in WT (black) and AnxA5-KO (red) cells upon 12 h DMSO, 5 μM and 10 μM cisplatin treatment. Data points represent the mean ± SEM for [Ca 2+ ] Matrix (n WT-DMSO = 63/6; n AnxA5-KO-DMSO = 75/6, n WT-5μM-cisplatin = 67/6; n AnxA5-KO-5μM-cisplatin = 71/6, n WT-10μM-cisplatin = 53/6; n AnxA5-KO-10μM-cisplatin = 54/6), and for [Ca 2+ ] IMS (n WT-DMSO = 64/6; n AnxA5-KO-DMSO = 66/6, n WT-5μM-cisplatin = 60/6; n AnxA5-KO-5μM-cisplatin = 74/6, n WT-10μM-cisplatin = 64/6; n AnxA5-KO-10μM-cisplatin = 63/6), and [Ca 2+ ] Cyto (n WT-DMSO = 64/6; n AnxA5-KO-DMSO = 68/6, n WT-5μM-cisplatin = 74/6; n AnxA5-KO-5μM-cisplatin = 84/6, n WT-10μM-cisplatin = 55/6; n AnxA5-KO-10μM-cisplatin = 83/6). The p -values for ( A ), from left to right, are: p = 0.3780 (ns), p = 0.0320 (* p < 0.05), and p = 0.0022 (** p < 0.01); for ( B ): p = 0.9716 (ns), p = 0.0640 (ns), and p = 0.0039 (** p < 0.01). ( D ) Bar graphs show the percentage of living cells and ( E ) late apoptosis, assessed by Annexin5-FITC/PI staining and FACS analysis in WT (black) and AnxA5-KO (red) cells upon 24 h DMSO, 5 μM and 10 μM cisplatin treatment. ( F ) Bar graphs show the percentage of living cells and ( G ) late apoptosis in WT (black) and AnxA5-KO (red) cells upon 24 h DMSO, 20 μM VBIT-4, 10 μM cisplatin, and cisplatin+VBIT-4 treatment. Data points represent the mean ± SEM (n WT-DMSO = 5; n AnxA5-KO-DMSO = 6, n WT-20μM-VBIT-4 = 6; n AnxA5-KO-20μM-VBIT-4 = 6, n WT-10μM-cisplatin = 6; n AnxA5-KO-10μM-cisplatin = 6, n WT-cisplatin+VBIT-4 = 6; n AnxA5-KO-cisplatin+VBIT-4 = 6). The p -values for ( D ), from left to right, are: p = 0.1775 (ns), p = 0.0043 (** p < 0.01), and p = 0.0095 (** p < 0.01); for ( E ): p = 0.6040 (ns), p = 0.0028 (** p < 0.01), and p < 0.0001 (**** p < 0.0001); for ( F ): p = 0.6787 (ns), p = 0.0582 (ns), p = 0.0037 (** p < 0.01), and p < 0.0001 (**** p < 0.0001); for ( G ): p = 0.8063 (ns), p = 0.1840 (ns), p < 0.0001 (**** p < 0.0001), and p < 0.0001 (**** p < 0.0001). ( H ) Representative immunoblot shows monomeric and dimeric VDAC1 levels. Uncropped blots are provided in the Source Data. ( I ) Bar graph shows the quantification of the immunoblot in WT (black) and AnxA5-KO (red) cells upon 48 h DMSO, 20 μM VBIT-4, 10 μM cisplatin, and cisplatin+VBIT-4 treatment (each color represents the experiments from the same day). Data points represent the mean ± SEM (n WT-all = 4; n AnxA5-KO-all = 4). The p -values, from left to right, are: p = 0.0003 (*** p < 0.001), p = 0.0037 (** p < 0.01), p = 0.0001 (*** p < 0.001), and p = 0.0005 (*** p < 0.001). n represents the number of cells/biological replicates (minimum of 3 independent experiments). Significant differences were assessed using either one-way ANOVA with Tukey’s multiple comparison tests (** p < 0.01, *** p < 0.001 and ns: not significant) and with the two-tailed unpaired Student’s t-test or Kolmogorov–Smirnov test (* p < 0.05, ** p < 0.01, **** p < 0.0001 and ns: not significant). .

    Article Snippet: VDAC1 siRNA (5′-3′) ACACUAGGCACCGAGAUUA , Microsynth , Waldeck-Weiermair et al ( ) (Front Cell Neurosci) .

    Techniques: Staining, Western Blot, Comparison, Two Tailed Test

    ( A ) Representative immunoblot shows monomeric and dimeric VDAC1 levels. Uncropped blots are provided in the Source data. ( B ) Bar graph shows the quantification of the immunoblot in WT (black) and AnxA5-KO (red) cells upon 24 h DMSO, 20 μM VBIT-4, 10 μM cisplatin, and cisplatin+VBIT-4 treatment (each color represents the experiments from the same day). Data points represent the mean ± SEM (n WT-all = 4; n AnxA5-KO-all = 4). ( C ) Representative immunoblot shows monomeric and dimeric VDAC1 levels in response to 48-hour DMSO, 20 μM VBIT-4, 10 μM selenite, and selenite + VBIT-4 treatment. ( D ) Bar graph shows the quantification of the immunoblot in panel ( C ). Data points represent the mean ± SEM (nWT-all = 3; nAnxA5-KO-all = 3). The p -values, from left to right, are: p = 0.0002 (*** p < 0.001), p = 0.0003 (*** p < 0.001), p = 0.0017 (** p < 0.01), and p = 0.0082 (** p < 0.01). ( E ) Bar graphs show the percentage of late apoptosis in WT (black) and AnxA5-KO (red) cells upon 48 h DMSO, 20 μM VBIT-4, 10 μM selenite, and selenite+VBIT-4 treatment. Data points represent the mean ± SEM (nWT-all = 3; nAnxA5-KO-all = 3). The p -values, from left to right, are: p = 0.1688 (ns), p > 0.9999 (ns), p = 0.0448 (* p < 0.05), and p = 0.1932 (ns). ( F ) Representative confocal images of WT and AnxA5-KO HeLa cells, expressing VDAC1-TC (green) and mitoDsRed (red), were captured (Scale bar = 5 μm). ( G ) Bar graph shows the quantification of the obtained confocal images indicating VDAC1 cluster size in μm 2 in WT (black) and AnxA5-KO (red) cells upon 12 h DMSO, 20 μM VBIT-4, 10 μM cisplatin, and cisplatin+VBIT-4 treatment. Data points represent the mean ± SEM (n WT-DMSO = 7; n WT-VBIT-4 = 6; n WT-cisp. = 8; n WT-cisp.+VBIT-4 = 3; n AnxA5-KO-DMSO = 7; n AnxA5-KO-VBIT-4 = 6; n AnxA5-KO-cisp . = 8; n AnxA5-KO-cisp.+VBIT-4 = 3). The p -values, from left to right, are: p = 0.0494 (* p < 0.05), p = 0.2773 (ns), p = 0.0126 (* p < 0.05), and p = 0.0168 (* p < 0.05). Significant differences were assessed using one-way ANOVA with Tukey’s multiple comparison tests or with the unpaired Student’s t-test (* p < 0.05, ** p < 0.01, *** p < 0.005, and ns: not significant). .

    Journal: The EMBO Journal

    Article Title: Annexin A5 controls VDAC1-dependent mitochondrial Ca 2+ homeostasis and determines cellular susceptibility to apoptosis

    doi: 10.1038/s44318-025-00454-9

    Figure Lengend Snippet: ( A ) Representative immunoblot shows monomeric and dimeric VDAC1 levels. Uncropped blots are provided in the Source data. ( B ) Bar graph shows the quantification of the immunoblot in WT (black) and AnxA5-KO (red) cells upon 24 h DMSO, 20 μM VBIT-4, 10 μM cisplatin, and cisplatin+VBIT-4 treatment (each color represents the experiments from the same day). Data points represent the mean ± SEM (n WT-all = 4; n AnxA5-KO-all = 4). ( C ) Representative immunoblot shows monomeric and dimeric VDAC1 levels in response to 48-hour DMSO, 20 μM VBIT-4, 10 μM selenite, and selenite + VBIT-4 treatment. ( D ) Bar graph shows the quantification of the immunoblot in panel ( C ). Data points represent the mean ± SEM (nWT-all = 3; nAnxA5-KO-all = 3). The p -values, from left to right, are: p = 0.0002 (*** p < 0.001), p = 0.0003 (*** p < 0.001), p = 0.0017 (** p < 0.01), and p = 0.0082 (** p < 0.01). ( E ) Bar graphs show the percentage of late apoptosis in WT (black) and AnxA5-KO (red) cells upon 48 h DMSO, 20 μM VBIT-4, 10 μM selenite, and selenite+VBIT-4 treatment. Data points represent the mean ± SEM (nWT-all = 3; nAnxA5-KO-all = 3). The p -values, from left to right, are: p = 0.1688 (ns), p > 0.9999 (ns), p = 0.0448 (* p < 0.05), and p = 0.1932 (ns). ( F ) Representative confocal images of WT and AnxA5-KO HeLa cells, expressing VDAC1-TC (green) and mitoDsRed (red), were captured (Scale bar = 5 μm). ( G ) Bar graph shows the quantification of the obtained confocal images indicating VDAC1 cluster size in μm 2 in WT (black) and AnxA5-KO (red) cells upon 12 h DMSO, 20 μM VBIT-4, 10 μM cisplatin, and cisplatin+VBIT-4 treatment. Data points represent the mean ± SEM (n WT-DMSO = 7; n WT-VBIT-4 = 6; n WT-cisp. = 8; n WT-cisp.+VBIT-4 = 3; n AnxA5-KO-DMSO = 7; n AnxA5-KO-VBIT-4 = 6; n AnxA5-KO-cisp . = 8; n AnxA5-KO-cisp.+VBIT-4 = 3). The p -values, from left to right, are: p = 0.0494 (* p < 0.05), p = 0.2773 (ns), p = 0.0126 (* p < 0.05), and p = 0.0168 (* p < 0.05). Significant differences were assessed using one-way ANOVA with Tukey’s multiple comparison tests or with the unpaired Student’s t-test (* p < 0.05, ** p < 0.01, *** p < 0.005, and ns: not significant). .

    Article Snippet: VDAC1 siRNA (5′-3′) ACACUAGGCACCGAGAUUA , Microsynth , Waldeck-Weiermair et al ( ) (Front Cell Neurosci) .

    Techniques: Western Blot, Expressing, Comparison

    AnxA5 regulates mitochondrial Ca 2+ signaling upon ER Ca 2+ release (upper panel). Apoptotic stimuli induce VDAC1 dimerization and apoptotic cell death (lower panel). Anx5 regulates the dimerization state by localizing in the VDAC1 microenvironment, thus affecting the level of apoptosis (lower left panel). In AnxA5-KO cells, cisplatin/selenite induces enhanced VDAC1 dimerization, leading to elevated apoptosis (lower right panel).

    Journal: The EMBO Journal

    Article Title: Annexin A5 controls VDAC1-dependent mitochondrial Ca 2+ homeostasis and determines cellular susceptibility to apoptosis

    doi: 10.1038/s44318-025-00454-9

    Figure Lengend Snippet: AnxA5 regulates mitochondrial Ca 2+ signaling upon ER Ca 2+ release (upper panel). Apoptotic stimuli induce VDAC1 dimerization and apoptotic cell death (lower panel). Anx5 regulates the dimerization state by localizing in the VDAC1 microenvironment, thus affecting the level of apoptosis (lower left panel). In AnxA5-KO cells, cisplatin/selenite induces enhanced VDAC1 dimerization, leading to elevated apoptosis (lower right panel).

    Article Snippet: VDAC1 siRNA (5′-3′) ACACUAGGCACCGAGAUUA , Microsynth , Waldeck-Weiermair et al ( ) (Front Cell Neurosci) .

    Techniques:

    ( a-d ) Proximity ligation assay (PLA) using anti-pan-IP 3 R, and anti-VDAC1/3 antibody (green) of HeLa cells expressing control plasmid (ER-mRFP) and ER-mitochondrial linkers (EMLs) (red). ( a ) Cartoon illustrating that only IP 3 Rs and VDAC1/3 juxta-positioned at ≤ 40 nm are labelled. Representative images ( b ) and quantification of the PLA-labelled area intensity of and PLA-EML Pearson colocalization coefficient ( d ). Scale bars = 20 µM. ( e-g ) Immunofluorescent analysis using anti-pan-IP 3 R antibody (green) in ER-mRFP and EML-expressing HeLa cells (red). ( e ) Cartoon illustrating that all IP 3 Rs present in the cells are labelled. Representative images ( f ) and quantification of IP 3 R-EML Pearson colocalization coefficient ( g ). Scale bars = 20 µM. ( h-j ) Localization of endogenous IP 3 R1 tagged with EGFP in HeLa cells (endogenous IP 3 R1-EGFP, green) upon expression of ER-EBFP, and 10nm- and 20nm-EMLs containing EBFP (magenta). ( h ) Cartoon illustrating that all endogenous IP 3 R1 receptors are tagged with EGFP. Representative images ( i ) and quantification of EGFP-EML Pearson colocalization coefficient ( j ). Scale bars = 20 µM. Whisker plots report data collected from 54-106 ( c ), 25-30 ( d ), 8-18 ( g ), 16-18 ( j ) cells from at least 3 independent coverslips analyzed from 3 independent cultures. One-way ANOVA, Tukey post hoc test. ** p < 0.01, *** p < 0.001, **** p < 0.0001. Representative images ( K ) and quantification of total cell lysates ( l ) and isolated MERCS ( m ) using anti-pan-IP 3 R antibody, anti-VDAC1/3 or anti-GRP75 antibody. Data are expressed as mean ± SEM of n = 3 independent experiments. Unpaired two-tailed Student’s t-test. **, p < 0.01.

    Journal: bioRxiv

    Article Title: ER-mitochondria distance is a critical parameter for efficient mitochondrial Ca 2+ uptake and oxidative metabolism

    doi: 10.1101/2024.07.24.604907

    Figure Lengend Snippet: ( a-d ) Proximity ligation assay (PLA) using anti-pan-IP 3 R, and anti-VDAC1/3 antibody (green) of HeLa cells expressing control plasmid (ER-mRFP) and ER-mitochondrial linkers (EMLs) (red). ( a ) Cartoon illustrating that only IP 3 Rs and VDAC1/3 juxta-positioned at ≤ 40 nm are labelled. Representative images ( b ) and quantification of the PLA-labelled area intensity of and PLA-EML Pearson colocalization coefficient ( d ). Scale bars = 20 µM. ( e-g ) Immunofluorescent analysis using anti-pan-IP 3 R antibody (green) in ER-mRFP and EML-expressing HeLa cells (red). ( e ) Cartoon illustrating that all IP 3 Rs present in the cells are labelled. Representative images ( f ) and quantification of IP 3 R-EML Pearson colocalization coefficient ( g ). Scale bars = 20 µM. ( h-j ) Localization of endogenous IP 3 R1 tagged with EGFP in HeLa cells (endogenous IP 3 R1-EGFP, green) upon expression of ER-EBFP, and 10nm- and 20nm-EMLs containing EBFP (magenta). ( h ) Cartoon illustrating that all endogenous IP 3 R1 receptors are tagged with EGFP. Representative images ( i ) and quantification of EGFP-EML Pearson colocalization coefficient ( j ). Scale bars = 20 µM. Whisker plots report data collected from 54-106 ( c ), 25-30 ( d ), 8-18 ( g ), 16-18 ( j ) cells from at least 3 independent coverslips analyzed from 3 independent cultures. One-way ANOVA, Tukey post hoc test. ** p < 0.01, *** p < 0.001, **** p < 0.0001. Representative images ( K ) and quantification of total cell lysates ( l ) and isolated MERCS ( m ) using anti-pan-IP 3 R antibody, anti-VDAC1/3 or anti-GRP75 antibody. Data are expressed as mean ± SEM of n = 3 independent experiments. Unpaired two-tailed Student’s t-test. **, p < 0.01.

    Article Snippet: The following primary antibodies were used: anti-IP 3 R (rabbit, 1:500, Abcam, Cat. AB108517) and anti-VDAC1/3 (mouse, 1:250, Abcam, Cat. AB14734).

    Techniques: Proximity Ligation Assay, Expressing, Control, Plasmid Preparation, Whisker Assay, Isolation, Two Tailed Test